Journal: Molecular Brain

Article Title: Cathepsin D expression level affects alpha-synuclein processing, aggregation, and toxicity in vivo

doi: 10.1186/1756-6606-2-5

Figure Lengend Snippet: Mice lacking ctsd gene expression show reduced levels of endogenous α-synuclein in Tris-soluble brain extracts . Western blot analyses of Tris brain extracts from 24-day old, wild-type (+) and ctsd -null mice (-) carried out under non-reducing (A) and reducing (B) conditions. Probing with monoclonal aSyn Ab, Syn-1 (and rabbit anti-mouse IgG secondary Ab) demonstrates a subtle reduction in the full-length, monomeric aSyn protein (aSyn, FL) at the 16 kDa position in ctsd -null mice. Representative examples of 24 mouse brains are shown (n = 4 per genetic group under non-reducing conditions; n = 16 per genotype under reducing conditions). The same blots reveal a broad, high molecular weight (HMW) band above 150 kDa (triple asterisks), and reactive bands at 50 kDa (double asterisks) and 25 (asterisk) kDa positions under non-reducing (A) and reducing (B) conditions, respectively. ( C) Immunoblotting with anti-β-synuclein Ab under reducing conditions reveals no difference at the 17 kDa monomeric (β-Syn, FL) protein position, but indicates elevation of lower molecular weight fragment(s) at ~13 kDa (β-Syn, ΔC) and a HMW-immunoreactive smear in cathD-deficient mice. (Note, no additional anti-β-synuclein Ab is available for corroboration).

Article Snippet: The rat SNCA gene was cloned out of a rat brain cDNA library using the primers GATATCGCCACCATGGATGTGTTCATGAAAGGACTT (forward) and CAAGACTATGAGCCTGAAGCCTCTTCTAGA (reverse), and inserted into the pcDNA3.1 vector (Invitrogen) using the EcoRV and Xba1 restriction sites. pCMV-XL5 vector with and without the human CTSD gene was purchased from Origene's TrueClone collection.

Techniques: Gene Expression, Western Blot, High Molecular Weight, Molecular Weight

Journal: Molecular Brain

Article Title: Cathepsin D expression level affects alpha-synuclein processing, aggregation, and toxicity in vivo

doi: 10.1186/1756-6606-2-5

Figure Lengend Snippet: Mice lacking ctsd gene expression exhibit intracellular α-synuclein accumulation in several regions of the brain . Serial, paraffin-embedded sections from 24-day old cathepsin D knock-out mice (CathD) (A-C) and age-matched, wild-type control (D-F) mice (n = 5) were probed by immunohistochemistry with affinity-purified, polyclonal aSyn Ab, hSA-2. (A) In the frontal cortex of cathepsin D knock-out mice, scattered neurons with prominent intracellular aSyn-reactivity are detectable (arrows). (B) In the thalamus of CathD-deficient mice, the neuropil staining is reduced when compared with control animals, and small grain-like aggregates of aSyn are visible. (C) In the cerebellum of CathD deficient mice, abnormal aSyn-positive accumulations of varying size can be observed in the granular cell layer and deep nuclei; those that appear cytoplasmic are identified by arrows. (D-F) As expected, aSyn-positive aggregates are not found in age-matched, wild-type mice processed in parallel. CC denotes corpus callosum. Scale bar, 25 μm.

Article Snippet: The rat SNCA gene was cloned out of a rat brain cDNA library using the primers GATATCGCCACCATGGATGTGTTCATGAAAGGACTT (forward) and CAAGACTATGAGCCTGAAGCCTCTTCTAGA (reverse), and inserted into the pcDNA3.1 vector (Invitrogen) using the EcoRV and Xba1 restriction sites. pCMV-XL5 vector with and without the human CTSD gene was purchased from Origene's TrueClone collection.

Techniques: Gene Expression, Knock-Out, Control, Immunohistochemistry, Affinity Purification, Staining

Journal: PLoS ONE

Article Title: Drug-Encoded Biomarkers for Monitoring Biological Therapies

doi: 10.1371/journal.pone.0137573

Figure Lengend Snippet: Glucuronidase assay substrates.

Article Snippet: Carboxyumbelliferyl β-D-glucuronide , CUGlcU , 386 nm , 445 nm , Marker Gene Technologies Inc., Eugene, USA.

Techniques: Marker